Lowed by 40 cycles of 95 for 30 seconds, 54 for 45 seconds,

Lowed by 40 cycles of 95 for 30 seconds, 54 for 45 seconds, and 72 for 30 seconds. The following primer sequences were adopted from previous reports: H19 and KvDMR [43,44], IG-DMR and MEG3 DMR [19], and PEG10 DMR [45]. The amplified products were cloned into the pGEM-T Easy vector (Promega, Madison, WI, USA), and 20 clones from each genomic sample were picked for sequencing. The sequences were analyzed by BiQ Analyzer software [46], and only non-clonal sequences are presented.Infection of human embryonic stem cells with small interfering RNA and small hairpin RNA lentiviruseshESC maintenance and EB formation were described above in the `Human embryonic stem cell culture’ section. For neuroectodermal sphere (NES) formation, 4-day-old EBs were cultured in N2 medium containing Dulbecco’s modified Eagle’s medium/F12, NEAA (1X), L-glutamine (2 mM), N2 supplement (1X), sodium pyruvate (1 mM), and basic fibroblast growth factor (20 ng/mL) (Gibco) for 3 days, followed by Matrigel attachment for 3 or 18 days. Half of the N2 medium was refreshed every 48 hours.Two knockdown construct types were used in this study. (i) Two MEG3-siRNA plasmids with different target sequences and scramble siRNA-GFP plasmids (Abcam Company). The MEG3-siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNAGFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNAGFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3-shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021). The shRNA plasmid and its target sequences for MEG3 are as follows: TL 320132C MEG3: gagaggttgtttcactggtatctattgca. Packaging, envelope, and siRNA or shRNA plasmids were transfected into 293 T cells to produce lentiviral particles. Harvested media containing lentivirus were concentrated and used to infect hESCs. The following two infection methods were used in these experiments: (i) Harvested media with lentivirus-containing siRNA plasmid were used to infect hESC clumps (50 to 250 cells per clump). (ii) Harvested media with lentivirus-Mo et al. Stem Cell Research Therapy 2015, 6:1 http://stemcellres.com/content/6/1/Page 5 ofFigure 1 (See legend on next page.)Mo et al. Stem Cell Research Therapy 2015, 6:1 http://stemcellres.com/content/6/1/Page 6 of(See figure on previous page.) Figure 1 Classification of MEG3-ON and MEG3-OFF human embryonic stem cells (hESCs) by detecting the expression of the DLK1-DIO3 locus-derived non-coding RNAs (ncRNAs). (A) The DLK1-DIO3 imprinted locus, which is highly conserved between mice and humans, including clusters of maternally expressed functional ncRNAs, which are marked in red. The human homologs of the Gtl2 and Rian mice genes are MEG3 and MEG8, respectively. Cycloheximide web Lollipops with closed circles represent methylated CpG regions, and open circles represent unmethylated CpG regions. Mat, maternal chromosome; Pat, paternal chromosome. (B) The hESCs with high expression levels of imprinted long non-coding RNAs (lncRNAs) (MEG3 and MEG8) and of several imprinted microRNAs (miRNAs) from PubMed ID:http://www.ncbi.nlm.nih.gov/pubmed/25432023 the DLK1-DIO3 locus (miR-127-3p, miR-154, miR-376c, miR-495, miR-494, and miR-496) were classified as MEG3-ON hESCs. The hESCs without detectable MEG3 expression accompanied by significant repression of other ncRNAs from the same locus were classified as MEG3-OFF hESCs. GAPDH was used as an internal control for mRNA expression analysis, and RNU48 was used as an internal control for miRNA expression analysis. The quantitation of lncRNA and miR.