L species. In the majority of these studies no adverse effects
L species. In the majority of these studies no adverse effects have been detected....
B response. In addition, different viability parameters as the ATP level
B response. In addition, different viability parameters as the ATP level, the WST-1 conversion,...
El of phospho-JNK was not affected by HLJDT treatment (P.0.05, Fig.
El of phospho-JNK was not affected by HLJDT treatment (P.0.05, Fig. 8). Moreover, compared...
A final buffer composition of 1 M GdnHCl, 3 M urea in 1XPBS
A final buffer composition of 1 M GdnHCl, 3 M urea in 1XPBS, pH...
Fragment that contains the cdN protein coding sequence, PCR reactions using
Fragment that contains the cdN protein coding sequence, PCR reactions using primers (59CGGAATTCATGGCGCGGAGCGTGCGC 39and...
Most of them also manifest hypersensitivity to NSAIDs, and their asthma remains poorly controlled
uently, the genes that are expressed in both regions were excluded. For example, the...
Notably, Pim1-expressing cells presented an increased cMyc transcriptional activity as well
Bub1 depletion from HeLa cells causes an increase in the G2/M population of HeLa...
E environment. In forest ecosystems, tree seedlings allow their roots to
E environment. In forest ecosystems, tree seedlings allow their roots to proliferate to acquire...
That have observed a similar degree of `RV resilience’ in the
That have observed a similar degree of `RV resilience’ in the setting of pressure...
Benzimidazole (DRB)] in nuclear extracts [11]. Thus, the presence of W049 protein
Benzimidazole (DRB)] in nuclear extracts . Thus, the presence of W049 protein has the...