After a single intraperitoneal dose of 7.5 mg/kg of cisplatin [39].In
After a single intraperitoneal dose of 7.5 mg/kg of cisplatin .In a study by...
D countries, the global prevalence of this special patient category is
D countries, the global prevalence of this special patient category is fortunately still low,...
Also in HeLa cells, downregulation of Pds5B levels results in centromeric cohesion defects
0 rpm. Supernatant was discarded and the pelleted nuclei were re-suspended in 100 l...
Ro stimulation of PBMCs with bacterial supernatantsPBMCs from healthy adult blood
Ro stimulation of PBMCs with bacterial supernatantsPBMCs from healthy adult blood donors were thawed...
Dies will be needed to determine the relationship, if any, between
Dies will be needed to determine the relationship, if any, between different mouse strains,...
L species. In the majority of these studies no adverse effects
L species. In the majority of these studies no adverse effects have been detected....
B response. In addition, different viability parameters as the ATP level
B response. In addition, different viability parameters as the ATP level, the WST-1 conversion,...
El of phospho-JNK was not affected by HLJDT treatment (P.0.05, Fig.
El of phospho-JNK was not affected by HLJDT treatment (P.0.05, Fig. 8). Moreover, compared...
A final buffer composition of 1 M GdnHCl, 3 M urea in 1XPBS
A final buffer composition of 1 M GdnHCl, 3 M urea in 1XPBS, pH...
Fragment that contains the cdN protein coding sequence, PCR reactions using
Fragment that contains the cdN protein coding sequence, PCR reactions using primers (59CGGAATTCATGGCGCGGAGCGTGCGC 39and...